View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16755_low_21 (Length: 290)
Name: NF16755_low_21
Description: NF16755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16755_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 20 - 280
Target Start/End: Complemental strand, 42067610 - 42067350
Alignment:
| Q |
20 |
ctactatggtgaaatttaaaggagtacttgcaacaactgttcttaaattttattttaacatctcannnnnnnctctacacatgtctttatatcacatcat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42067610 |
ctactatggtgaaatttaaaggagtacttgcaacaactgttcttaaattttattttaacatctcatttttttctctacacatgtctttatatcacatcat |
42067511 |
T |
 |
| Q |
120 |
taacatgtcatatttataatagaacagtgctatagcgaattattatttcacgaagcattgtgaaacgttataaaagatctccaaaatcactttacataga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42067510 |
taacatgtcatatttataatagaacagtgctatagcgaattattatttcacgaagcattgtgaagcgttatagaagatctccaaaatcactttacataga |
42067411 |
T |
 |
| Q |
220 |
actttagtagaaaatacggtaggcaaaagtgttaattagccaatcaaattaattccctatg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42067410 |
actttagtagaaaatacggtaggcaaaagtgttaattagccaatcaaattaattccctatg |
42067350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University