View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16756_high_22 (Length: 254)
Name: NF16756_high_22
Description: NF16756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16756_high_22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 254
Target Start/End: Original strand, 48235396 - 48235641
Alignment:
| Q |
9 |
attattcttagtatcagtaaaaacttgattatcattacatccaaggcctcttaatctattaagctctggaagcacaactgatgcaagatttggcctatct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235396 |
attattcttagtatcagtaaaaacttgattatcattaaatccaaggcctcttaatctattaagctctggaagcacaactgatgcaagatttggcctatct |
48235495 |
T |
|
| Q |
109 |
ttcttgcagagttctgcacaattcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcaccgcagaatcaagaatctccgaaaact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48235496 |
ttcttgcagagttctgcacaattcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcaccgcagaatcaagaatctctgaaaact |
48235595 |
T |
|
| Q |
209 |
gctccttttcaattgcccttttaacatgatgagaaagtcccatagg |
254 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235596 |
ggtccttttcaattgcccttttaacatgatgagaaagtcccatagg |
48235641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 214 - 251
Target Start/End: Complemental strand, 3686899 - 3686862
Alignment:
| Q |
214 |
ttttcaattgcccttttaacatgatgagaaagtcccat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3686899 |
ttttcaattgcccttttaacatgatgagaaagtcccat |
3686862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 182
Target Start/End: Complemental strand, 42674307 - 42674255
Alignment:
| Q |
130 |
ttcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcac |
182 |
Q |
| |
|
||||| |||||||| |||| ||||| ||||||||| || |||||||||||||| |
|
|
| T |
42674307 |
ttcaaagctaatttagcaagtgataaagcctcttcgaccggccaatcagtcac |
42674255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University