View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16756_high_26 (Length: 238)
Name: NF16756_high_26
Description: NF16756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16756_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 89 - 196
Target Start/End: Complemental strand, 36994426 - 36994319
Alignment:
| Q |
89 |
atatatacccagctgctttgtaactatatgttagcccttttaattcactttgtcatctttcaatgaataaattaggagttttgtcaaatataaatgagtt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36994426 |
atatatacccagctgctttgtaactatatgttagcccttttaattccccttgtcatctttcaatgaataaattaggagttttgtcaaatataaatgagtt |
36994327 |
T |
 |
| Q |
189 |
atagcata |
196 |
Q |
| |
|
|||||||| |
|
|
| T |
36994326 |
atagcata |
36994319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 84 - 148
Target Start/End: Complemental strand, 36988561 - 36988495
Alignment:
| Q |
84 |
caaaaatatatacccagctgctttgtaactatat--gttagcccttttaattcactttgtcatcttt |
148 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
36988561 |
caaaaatatatatcccgctgctttgtaactatatatgttagcccttttaattcactttggcatcttt |
36988495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University