View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16756_high_30 (Length: 209)
Name: NF16756_high_30
Description: NF16756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16756_high_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 33817571 - 33817390
Alignment:
| Q |
14 |
aagaaaatgcgatatctttttccggattaacactcttccaaaccttagaaatgatttggagttgatccatcgagaaaggtagatttgccgagaaagtcca |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
33817571 |
aagaaaatgcgataactttttccggattaacactcttccaaaccttagaaatgatttggagttgatccatcgagaaagatagatttgccgagagagtcca |
33817472 |
T |
|
| Q |
114 |
ataagtcaagttattcgagtaaataccactagtattatgaacccaacgatcatcaatcaaggttaacaaaactccaactata |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817471 |
ataagtcaagttattcgagtaaataccactagtattatgaacccaacgatcatcaatcaaggttaacaaaactccaactata |
33817390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University