View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16756_low_15 (Length: 305)
Name: NF16756_low_15
Description: NF16756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16756_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 10 - 288
Target Start/End: Original strand, 1179800 - 1180078
Alignment:
| Q |
10 |
agaagaaccagatcggcgcgtgaacgaaatacggcgcgtggataacatcgtagggagcgtgtaaccgttaggaagaagacgaagctcagaaagagtgaga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179800 |
agaagaaccagatcggcgcgtgaacgaaatacggcgcgtggataacatcgtagggagcgtgtaaccgttaggaagaagacgaagctcagaaagagtgaga |
1179899 |
T |
|
| Q |
110 |
cggcgtggaatgatatgataacggagagtatcggtgtaagacgacgcagtttgcgtcatgtcgagagcgaagagtgaagaatcagtgggagcgaagaaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179900 |
cggcgtggaatgatatgataacggagagtatcggtgtaagacgacgcagtttgcgtcatgtcgagagcgaagagtgaagaatcagtgggagcgaagaaag |
1179999 |
T |
|
| Q |
210 |
tgaaagagtttgtggcgtttgaatttggatcaagaagatcgattcgaagatcagaggtgaggattgcattgcagaagag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1180000 |
tgaaagagtttgtggcgtttgaatttggatcaagaagatcgattcgaagatcggaggtgaggattgcattgcagaagag |
1180078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University