View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16756_low_18 (Length: 275)
Name: NF16756_low_18
Description: NF16756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16756_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 36207007 - 36207244
Alignment:
| Q |
19 |
ggtgatgttgtagcatgagtgactgtcttatcattgttcttttcattttgggcgtgttgctgactatattgaagggactctaggagagaaacgatcaagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207007 |
ggtgatgttgtagcatgagtgactgtcttatcattgttcttttcattttgggcgtgttgctgactatattgaagggactctaggagagaaacgatcaagt |
36207106 |
T |
 |
| Q |
119 |
acaaataggtggagccatagaacagaactgaccaatagaaacccaaaatagtataaatcacaataaccagaaccttcccagtgaagatgaactttaccgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207107 |
acaaataggtggagccatagaacagaactgaccaatagaaacccaaaatagtataaatcacaataaccagaaccttcccagtgaagatgaactttaccgg |
36207206 |
T |
 |
| Q |
219 |
agaaaaaagatcgatatcgaaagttccaagtagaaccc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207207 |
agaaaaaagatcgatatcgaaagttccaagtagaaccc |
36207244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 22 - 74
Target Start/End: Complemental strand, 10989280 - 10989228
Alignment:
| Q |
22 |
gatgttgtagcatgagtgactgtcttatcattgttcttttcattttgggcgtg |
74 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
10989280 |
gatgttgtagcataagtgactaccttatcattgttcttttcagtttgggcgtg |
10989228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University