View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16756_low_24 (Length: 245)
Name: NF16756_low_24
Description: NF16756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16756_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 5440144 - 5440383
Alignment:
| Q |
1 |
taaacacaaaacttattttgctatatttacatctctttaccggtcttccattttctatctgttcatgtatttcttggtgtagctnnnnnnncgtcttggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
5440144 |
taaacacaaaacttattttgctatatttacatatctttaccggtcttcctttttctatctgttcatgtatttcttggtgtagctaaaaaaacgttttggg |
5440243 |
T |
|
| Q |
101 |
aaatttttcggttaaaaaggaaaatatagtaaaatgagtgtgagccccgtggtttatttatttttgttgaaaagggtgcgtgatagccatggaggagaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5440244 |
aaatttttcggttaaaaaggaaaatatagtaaaatgagtgtgagccccgtgatttatttatttttgttgaaaagggtgcgtgatagccatggaggagaag |
5440343 |
T |
|
| Q |
201 |
aatttcattaaacattgattgtttcttttccaaccctatg |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5440344 |
aatttcattaaacattgactgtttcttttccaaccctatg |
5440383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University