View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16756_low_26 (Length: 238)

Name: NF16756_low_26
Description: NF16756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16756_low_26
NF16756_low_26
[»] chr7 (2 HSPs)
chr7 (89-196)||(36994319-36994426)
chr7 (84-148)||(36988495-36988561)


Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 89 - 196
Target Start/End: Complemental strand, 36994426 - 36994319
Alignment:
89 atatatacccagctgctttgtaactatatgttagcccttttaattcactttgtcatctttcaatgaataaattaggagttttgtcaaatataaatgagtt 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||    
36994426 atatatacccagctgctttgtaactatatgttagcccttttaattccccttgtcatctttcaatgaataaattaggagttttgtcaaatataaatgagtt 36994327  T
189 atagcata 196  Q
    ||||||||    
36994326 atagcata 36994319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 84 - 148
Target Start/End: Complemental strand, 36988561 - 36988495
Alignment:
84 caaaaatatatacccagctgctttgtaactatat--gttagcccttttaattcactttgtcatcttt 148  Q
    |||||||||||| || ||||||||||||||||||  ||||||||||||||||||||||| |||||||    
36988561 caaaaatatatatcccgctgctttgtaactatatatgttagcccttttaattcactttggcatcttt 36988495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University