View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16756_low_28 (Length: 218)
Name: NF16756_low_28
Description: NF16756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16756_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 4498631 - 4498831
Alignment:
| Q |
1 |
gtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttggatttgcagcagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498631 |
gtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacatcagatttctacataggaatgggagttggatttgcagcagg |
4498730 |
T |
 |
| Q |
101 |
gttttggggggtttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgataccttt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498731 |
gttttggggggtttgcattgctactttcttgatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgataccttt |
4498830 |
T |
 |
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
4498831 |
g |
4498831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 201
Target Start/End: Complemental strand, 4329267 - 4329078
Alignment:
| Q |
12 |
aaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttggatttgcagcagggttttgggggg |
111 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| |||||| | |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329267 |
aaacaagttttggagcgtggaaattctgatgctggtttcgttgacacatcagatttctacgtaggaatgggagttggatttgcagcagggttttgggggg |
4329168 |
T |
 |
| Q |
112 |
tttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgatacctttg |
201 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4329167 |
tttgcattgctattttctttaacagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgtttatgagacctttg |
4329078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University