View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16757_high_16 (Length: 440)
Name: NF16757_high_16
Description: NF16757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16757_high_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 150 - 440
Target Start/End: Original strand, 38566452 - 38566731
Alignment:
| Q |
150 |
ttgctacaacaattgtcacccatctcaggactgtcaccaatgctaaacatgcttggttattcacaccttgaatggtctcacaactgaataatgtga--tt |
247 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
38566452 |
ttgctacaacaattgttacccatctcaggactgtcaccaatgctaaacatgcttggttattcaca-----------------actgaataatgtgagatt |
38566534 |
T |
 |
| Q |
248 |
gcagttgctcttcgaagtagagaaagtcccattgaatttgctgaactccatgagaaactcatggactttgataggttgttgcatcgtgaggaaccaacta |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38566535 |
gcagttgctcttcgaagtagagaaagtcccattgaatttgctgaactccatgagaaacccatggactttgataggttgctgcatcgtgaggaaccaacta |
38566634 |
T |
 |
| Q |
348 |
tgtc----atattctctagttgttactccaaatgcagcaacgagatcctgcggccaacaacatcagcctaaacggacctaatcatactgcaagaaat |
440 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
38566635 |
tgtcatatatattctctagttgttactgcaaatgcagcaacaagatcctgcggccaacaacatcagccaaaacagacctaatcatactgcaagaaat |
38566731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University