View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16757_high_43 (Length: 331)
Name: NF16757_high_43
Description: NF16757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16757_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 23141451 - 23141561
Alignment:
| Q |
18 |
gattttgggtttaggttgctcgatttcaggattctgggtttaggttcatggtttttgattctggcttcttgggttttcgatgcttcacacaatgaaaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23141451 |
gattttgggtttaggttgctcgatttcaggattctgggtttaggttcatgggttttgattctggcttcttgggttttcgatgcttcacacgatgaaaatc |
23141550 |
T |
 |
| Q |
118 |
ccaattctggg |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
23141551 |
ccaattctggg |
23141561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 219 - 321
Target Start/End: Original strand, 23141652 - 23141754
Alignment:
| Q |
219 |
gatcttctaaatttgtaatgcaattaagatcaatataatcgaaacaaattatatacacaaaaatcagacctcttcctatatctatttttccttttactct |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
23141652 |
gatcttctaaatttgtaatgcaattaagatcaatataatcgaaacaaattatatacacaaaaatcagacgtcttcctatatttatttttccttttactct |
23141751 |
T |
 |
| Q |
319 |
gtg |
321 |
Q |
| |
|
||| |
|
|
| T |
23141752 |
gtg |
23141754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 45416947 - 45417054
Alignment:
| Q |
18 |
gattttgggtttaggttgctcgatttcaggattctgggtttaggttcatggtttttgattctggcttcttgggttttcgatgcttcacacaatgaaaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45416947 |
gattttgggtttaggttgctcgatttcaggattctgggtttaggttcatggtttttgattctggcttcttgggttttcgatgcttcacacgatgaaaatc |
45417046 |
T |
 |
| Q |
118 |
ccaattct |
125 |
Q |
| |
|
||||||| |
|
|
| T |
45417047 |
tcaattct |
45417054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University