View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16757_high_76 (Length: 217)
Name: NF16757_high_76
Description: NF16757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16757_high_76 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 84 - 200
Target Start/End: Complemental strand, 40662365 - 40662249
Alignment:
| Q |
84 |
aagaatctctgattgattaagaagattgctcttgcacattgtagccattctttatttgctctgcaattcatattactatttgtatacatggatgattgtg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40662365 |
aagaatctctgattgattaagaagattgctcttgcacattgtagccattctttatttgctctgcaattcatattactatttgtatacatggatgattgtg |
40662266 |
T |
|
| Q |
184 |
agtggtggttaattaca |
200 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40662265 |
agtggtggttaattaca |
40662249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 89 - 200
Target Start/End: Complemental strand, 40675902 - 40675791
Alignment:
| Q |
89 |
tctctgattgattaagaagattgctcttgcacattgtagccattctttatttgctctgcaattcatattactatttgtatacatggatgattgtgagtgg |
188 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40675902 |
tctctggttgattaagaagattgcacttgcacattgcagccattctttatctgctctgcaattcatattactatttgtatacatggatgattgtgagtgg |
40675803 |
T |
|
| Q |
189 |
tggttaattaca |
200 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40675802 |
tggttaattaca |
40675791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University