View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16757_low_43 (Length: 334)
Name: NF16757_low_43
Description: NF16757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16757_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 33814709 - 33814397
Alignment:
| Q |
1 |
gttgtttggttagagagtgaacaattggctactcagcttggctacaaatgttctcatgcatttcttgaggggaatatggttgcagacgctttgacaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
33814709 |
gttgtttggttagagagtgaacaattggctactcagcttggctacaaatgttctcatgcatttcttgaggggaatatggttgcggacgctttggcaaaaa |
33814610 |
T |
 |
| Q |
101 |
a-cggacaggggttggctctttgcacatcacaatggtggaatgacccaccacagtttattctttctttgttaaatagagagcaaataggtttacctttca |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33814609 |
aacggacaggggttggctctttgcacatcacaatggtggaatgacccaccacagtttattctttctttgttaaatagaaagcaaataggtttacctttca |
33814510 |
T |
 |
| Q |
200 |
ctagattcactatgtaattcattgtacatatggtgcaggcctttcctgtttttaataccattcattgcttgatcnnnnnnntaatcagaaatatgtccta |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
33814509 |
ctagattcactatgtaattcattgtacatatggtgcaggcctttcctgtttttaataccattcattgcttgatcaaaa----aaatagaaatatgtccta |
33814414 |
T |
 |
| Q |
300 |
gtcttgtaagatatgtg |
316 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33814413 |
gtcttgtaagatatgtg |
33814397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University