View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16757_low_44 (Length: 332)
Name: NF16757_low_44
Description: NF16757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16757_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 3884160 - 3884476
Alignment:
| Q |
1 |
cttggtacttacctttcatttcaccgcttgaatgttgtgttttgtaacatactatcataactgaattttgtttcattttagggacatgataaagatgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3884160 |
cttggtacttacctttcatttcaccgcttgaatgttgtgttttgcaacatactatcataactgaattttgtttccttttagggacatgataaagatgttc |
3884259 |
T |
|
| Q |
101 |
tttccatttgttgggatagaacgggaaagtatattgcctctgtcagtgaagattgtgcacgagtctggtcggacggagaatgcatcggcgagttgcattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3884260 |
tttccatttgttgggatagaacgggaaagtatattgcctctgtcagtgaagattgtgcacgagtctggtcgaacggagaatgcatcggcgagttgcattc |
3884359 |
T |
|
| Q |
201 |
aaacgggaacaagtttcaatcgtgcatatttcatccgggatattgtaacctcttagttattggtggctatcaggtaagcccttcttccatcatgtgattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884360 |
aaacgggaacaagtttcaatcgtgcatatttcatccgggatattgtaacctcttagttattggtggctatcaggtaagcccttcttccatcatgtgattg |
3884459 |
T |
|
| Q |
301 |
atatttttgcctttgcc |
317 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
3884460 |
atatttttgcccttgcc |
3884476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 35240846 - 35240794
Alignment:
| Q |
133 |
attgcctctgtcagtgaagattgtgcacgagtctggtcggacggagaatgcat |
185 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||||||| ||||||| |
|
|
| T |
35240846 |
attgcctctgtcagtgaagatgatgtacgtgtctggtcggacggacaatgcat |
35240794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 133 - 171
Target Start/End: Complemental strand, 35237828 - 35237790
Alignment:
| Q |
133 |
attgcctctgtcagtgaagattgtgcacgagtctggtcg |
171 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
35237828 |
attgcctctgtcactgaagattgtgcacgtgtctggtcg |
35237790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University