View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16757_low_58 (Length: 274)
Name: NF16757_low_58
Description: NF16757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16757_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 82 - 259
Target Start/End: Complemental strand, 3512912 - 3512735
Alignment:
| Q |
82 |
ggtatcatcaattctatatattaaattccatgaatctagcaagtcaaggaatataaagaaggagaaggaatatttaccagcaggctgcagaatgctaact |
181 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3512912 |
ggtatcatcaattctttatattaaattccatgaatctagctagtcaaggaatataaagaaggagaaggaatatttaccagcaggctgcagaatgctaact |
3512813 |
T |
|
| Q |
182 |
cttaacaccatgtttcagtgatttagtaataaagggaacctggcaaatccgaagaaataatatagctgtaataaaact |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3512812 |
cttaacaccatgtttcagtgatttagtaataaagggaacctggcaaatccgaataaataatatagctgtaataaaact |
3512735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 197 - 257
Target Start/End: Original strand, 3651025 - 3651082
Alignment:
| Q |
197 |
cagtgatttagtaataaagggaacctggcaaatccgaagaaataatatagctgtaataaaa |
257 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
3651025 |
cagtgacttagtagtaaagggaacctggcaaatcc---gaaataatatagctttaataaaa |
3651082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 224
Target Start/End: Complemental strand, 34851974 - 34851916
Alignment:
| Q |
166 |
ctgcagaatgctaactcttaacaccatgtttcagtgatttagtaataaagggaacctgg |
224 |
Q |
| |
|
|||||| ||||||| | |||| |||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
34851974 |
ctgcaggatgctaaattttaataccatgcctcactgatttagtaataaagggaacctgg |
34851916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University