View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16757_low_70 (Length: 240)
Name: NF16757_low_70
Description: NF16757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16757_low_70 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 2145273 - 2145476
Alignment:
| Q |
17 |
acttcaattataagtgttggatcttgatcggacgataaccaaatcttaattgcatgagctttttacgtaaaattatacctagtgtgtttttcactgtaca |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2145273 |
acttaaattataagtgttggatcttgatcggacgataaccaaatcttaattgcatgaactttttacgtaaaattatacctagtgtgtttttcactgtaca |
2145372 |
T |
 |
| Q |
117 |
taatttgcctttctatttttgtttgatccccttaaaacatccatactggaaagttatttcataaattataagtagttttgttttgtataatagattaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2145373 |
taatttgcctttctatttttgtttgatccccttaaaacatccatactggaaagttatttcataaattataagtagttttgttttgtataatagattaaat |
2145472 |
T |
 |
| Q |
217 |
atta |
220 |
Q |
| |
|
|||| |
|
|
| T |
2145473 |
atta |
2145476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University