View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_high_17 (Length: 444)
Name: NF16758_high_17
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 10103284 - 10103198
Alignment:
| Q |
11 |
tatgaaataataaatttggaaatccttcactaaataggctgatctttttagttcgagttcagttgaaagaagcttttagaattatatta |
99 |
Q |
| |
|
|||| |||||| | || ||||||||||||||||||| |||||| ||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10103284 |
tatgcaataatgacttgggaaatccttcactaaataagctgat-tttttagtt-gagttaagttgaaagaagcttttagaattatatta |
10103198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University