View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_high_43 (Length: 269)
Name: NF16758_high_43
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_high_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 51342181 - 51341936
Alignment:
| Q |
8 |
atattattctgtgatgacatatggtacatgatattcattctatcaattggagttggagtgagttttagtgcatcatcagtacttttattcacctcagtta |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
51342181 |
atattattttgtgatgacatatggtacatgatattcattctatcaattggagttggagtgagtttttgtgcatcatcggtacttttattcacctcagtta |
51342082 |
T |
|
| Q |
108 |
ttctcccttcaacttggaggttaacaggaggttatgtgtattcgaggataacaaggatgacaataggatacttgttcctttatgcctctgctttggtcat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51342081 |
ttctcccttcaacttggaggttaacaggaggttatgtgtattcgaggataacaaggatgacaataggatacttgttcctttatgcctctgctttggtcat |
51341982 |
T |
|
| Q |
208 |
gggtctgttttctactatgtctggtgttgttttggtctatgatttc |
253 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51341981 |
gggtttgttttctactatgtctggtgttgttttggtctatgatttc |
51341936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University