View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_25 (Length: 401)
Name: NF16758_low_25
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 209 - 387
Target Start/End: Original strand, 8262189 - 8262367
Alignment:
| Q |
209 |
gtccatgcttattagtccattataggagtgtcttcggtatagagtgggtagggaaggggttgaaaaatggatgaggagtgttgaaagttcataaggctgg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8262189 |
gtccatgcttattagtccattataggagtgtcatcggtatagagtgggtagggaaggggttgaaaaatggatgaggagtgttgaaagttcataaggctga |
8262288 |
T |
 |
| Q |
309 |
gaaataaataaacctacttgaaaataatttgagttttgaattgctgattaatttgttcaacctggttctttgattaaat |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
8262289 |
taaataaataaacctacttgaaaataatttgagttttgaattggtgattaatttgttcaacctggttctttgatcaaat |
8262367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 16 - 105
Target Start/End: Original strand, 8262023 - 8262113
Alignment:
| Q |
16 |
aagaaaaatagtgagaggaacttggtctaaaatttatg-aattaattatgttatataggtcagactagataaataattaactagtttcttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
8262023 |
aagaaaaatagtgagaggaacttggtctaaaatttatgaaattaattatgttatgtaggtcagactagacaaataaataactagtttcttt |
8262113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University