View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_27 (Length: 376)
Name: NF16758_low_27
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 10 - 376
Target Start/End: Complemental strand, 16688134 - 16687768
Alignment:
| Q |
10 |
tgagaagaagcaacattgacgtcgcagaatgcgacgggagagaggatggtgtcagcttaactctaaagagtatggatcccaaaggaagagccacgactat |
109 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16688134 |
tgagaagaagcaacatcgacgtccccttctgcgacgggagagaggatggtgtcagcttaactctaaagagtatggatcccaaaggaagagccacgactat |
16688035 |
T |
|
| Q |
110 |
gttgtagctttcatcagtggttttcttagcacaaggtgaatgagagagcgtagcaaaaaatggttatggaaacactgaaacggttacagtggttgaatca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
16688034 |
gttgtagctttcatcagtggttttcttagcacaaggtgaacgagagagcgtagcaaaaaatggttatggaaacaccgaaacggttatggtggttgaatca |
16687935 |
T |
|
| Q |
210 |
aaggactccaatggaaacgatgaagttttccctccttccagtgccaatgttttggagtagaccagggtagagatgcattgtcgaatatgatcatgctatt |
309 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16687934 |
aaggactccgatggaaacgatgaagttttccctccttccagtgccaatgttttggagtagaccagggtagagatgcattgtcgaatatgatcatgctatt |
16687835 |
T |
|
| Q |
310 |
gatcagagtcaagtgcgagggaggaaagattatggagcggatgagataattctctggcgagcggaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16687834 |
gatcagagtcaagtgcgagggaggaaagattatggagcggatgagataattctctggcgagcggaaa |
16687768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University