View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_33 (Length: 349)
Name: NF16758_low_33
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 9 - 333
Target Start/End: Complemental strand, 38039649 - 38039325
Alignment:
| Q |
9 |
catcatcattaaattcctcctctacaagactacaacattcacctaacctctttctttctcatatcttctaacttcatttttcaccccttaacgctcgctt |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
38039649 |
catcatcattagattcctcctctacaagactacaacattcacctaacctctttctttctcatatcttctaacttcatttttcacaccttaatgctcgctt |
38039550 |
T |
|
| Q |
109 |
caaaatcatccactttatttcccggcaaccaccgcgccggaaatcaccctcctccaccgtggtaagatttcctctcttttttcccttactcttgtcgtga |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039549 |
caaaatcatccactttatttcccggcgaccaccgcgccggaaatcaccctcctccaccgtggtaagatttcctctcttttttcccttactcttgtcgtga |
38039450 |
T |
|
| Q |
209 |
tacttcatgcatgtgctgtactgtactgaaattcatgtattttcttctctgtttgttccaacaccgtaacaggacaacaccaccgtcaccggagcttcac |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039449 |
tacttcatgcatgtgctgtactgtactgaaattcatgtattttcttctctgtttgttccaacaccgtaacaggacaacaccaccgtcaccggagcttcac |
38039350 |
T |
|
| Q |
309 |
accggaacattacttccgtcatggt |
333 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
38039349 |
accggaacattactgccgtcatggt |
38039325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University