View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_36 (Length: 339)
Name: NF16758_low_36
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 23 - 189
Target Start/End: Original strand, 6475821 - 6475986
Alignment:
| Q |
23 |
aacaactaacacgactagtagtaagtaagtaactatagttaagttaactaaccattgattacaaaatgccagttgtagaaaacatggagcattcattcaa |
122 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6475821 |
aacaactaacaagactagtagtaagtaagtaactatagttaagttaactaaccat-gattacaaaatgccagttgtagaaaacatggagcattcattcaa |
6475919 |
T |
|
| Q |
123 |
tctaccgcaaaataatgcaatacaaacgtaacatcaaaacccaaaaccaaaaccgaaattcacattt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6475920 |
tctaccgcaaaataatgcaatacaaacgtaacatcaaaacccaaaaccaaaaccgaaattcacattt |
6475986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 213 - 325
Target Start/End: Original strand, 6476004 - 6476116
Alignment:
| Q |
213 |
gatccaaacgcaatgctaagagatgaaatcattggttccaaaagcgcaaggcacagcaccaccgccgctgtatcttcgaataaggttcttgtggcggtta |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6476004 |
gatccaaacgcaatgctaagagatgaaatcattggttccaaaagcgcaaggcacagcaccaccgccgctgtatcttcgaataaggttctcgtggcggtta |
6476103 |
T |
|
| Q |
313 |
aagcggagaaggt |
325 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6476104 |
aagcggagaaggt |
6476116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University