View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_39 (Length: 307)
Name: NF16758_low_39
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 4774758 - 4774870
Alignment:
| Q |
1 |
aaacatttcgcaggagataatctcttccccttacttaaatgcatcaatgtctttcttttaagaatcgatatcaatttttgtttacggaacaataaaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774758 |
aaacatttcgcaggagataatctcttccccttacttaaatgcatcaatgtctttcttttaagaatcgatatcaatttttgtttacggaacaataaaataa |
4774857 |
T |
 |
| Q |
101 |
accgtttccttca |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4774858 |
accgtttccttca |
4774870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 185 - 307
Target Start/End: Original strand, 4774941 - 4775063
Alignment:
| Q |
185 |
tttggggttaataccttaaataaacactaatttagcaatgactgattttcttaaaaggctnnnnnnntgatatattaacaaatcaggatcaactgtctca |
284 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||| |
|
|
| T |
4774941 |
tttggggttaatatcttaaataaacactaatttagcaatgactgattttcttaaaaggctaaaaaaatggtatattaacaaatcaggatcaactgtttca |
4775040 |
T |
 |
| Q |
285 |
gcataggtgtacgaaaccaaccc |
307 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4775041 |
gcataggtgtacgaaaccaaccc |
4775063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University