View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_40 (Length: 304)
Name: NF16758_low_40
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 89 - 289
Target Start/End: Original strand, 6878044 - 6878244
Alignment:
| Q |
89 |
tggaatatttcaacgagaaattagtgtttcaaagaaagcaagtgcaaaatttcaaggaaacatcgttatggaaacaaacatttgacaaaacggttgggat |
188 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878044 |
tggaatatttcaatgagaaattagtgtttcaaagaaagcaagtgcaaaattttaaggaaacatcattatggaaacaaacatttgacaaaacggttgggat |
6878143 |
T |
|
| Q |
189 |
catggcaaggcttgtgtgcattgtgtatgcaagaatatgctccgttttcggagcatacattaatgaagaacaggatgagaacaacaattccatgctcttt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878144 |
catggcaaggcttgtgtgcattgtgtatgcaagaatatgctccgttttcggagcatacattaatgaagaacaggatgagaacaacaattccatgctcttt |
6878243 |
T |
|
| Q |
289 |
g |
289 |
Q |
| |
|
| |
|
|
| T |
6878244 |
g |
6878244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University