View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_50 (Length: 252)
Name: NF16758_low_50
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 27874152 - 27873923
Alignment:
| Q |
1 |
tgctaaaagtgaatatggatttttataggataagttttatcagagattcagagtgcattatgcaaccaacgtacaacacgtttcaagtgatatatagcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27874152 |
tgctaaaagtgaatatggatttttataggataagttttattagagattcagagtgcattatgcaaccaacgtacaacacgtttcaagtgatatatagcta |
27874053 |
T |
|
| Q |
101 |
gtacagtaaaatttcatgtcaaagataatttgagattgcaacttgaattcaattatgcttcttttggactttagcatagttatgaacgcgtggcttgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27874052 |
gtacagtaaaatttcatgtcaaagataatttgagattgcaacttgaattcaattatgcttcttttggactttagtatagttatgaacgcgtggcttgtgt |
27873953 |
T |
|
| Q |
201 |
tatgaggaa-aaaacaaactgccacacttt |
229 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
27873952 |
tatgaggaaaaaaacaaactgccacacttt |
27873923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University