View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_54 (Length: 238)
Name: NF16758_low_54
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 11769240 - 11769451
Alignment:
| Q |
18 |
cccaccacgtaacgaaaacacatgatcccccatgcagccagtctgtcaacggctagattccatcttgaagagtttattctcttaaatcgaacggtccaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11769240 |
cccaccacgtaacgaaaacacatgatcccccatgcagccagtctgtcaacggctagattccatcttcaagagtttattctcttaaatcgaacggtccaga |
11769339 |
T |
 |
| Q |
118 |
tcatctctcttataccccactaaatcattgcatcatcactcaacacaacacccaaacactaatccccaatccctttttctacgcggagaagggaacggcg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11769340 |
tcatctctcttataccccactaaatcattgcatcatcactcaacacaacacgcaaacact-atccccaatccctttttctacgcggagaagggaacggcg |
11769438 |
T |
 |
| Q |
218 |
ctgttttcatctc |
230 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
11769439 |
ctgttctcatctc |
11769451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 150 - 198
Target Start/End: Complemental strand, 8359718 - 8359670
Alignment:
| Q |
150 |
tcatcactcaacacaacacccaaacactaatccccaatccctttttcta |
198 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
8359718 |
tcatcactcaacacaacacccaaacaccatcccccaatccctttttcta |
8359670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 150 - 198
Target Start/End: Original strand, 39291886 - 39291934
Alignment:
| Q |
150 |
tcatcactcaacacaacacccaaacactaatccccaatccctttttcta |
198 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
39291886 |
tcatcactcaacacaacacccaaacaccatgccccaatccctttttcta |
39291934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University