View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16758_low_62 (Length: 201)
Name: NF16758_low_62
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16758_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 10 - 185
Target Start/End: Complemental strand, 51342111 - 51341936
Alignment:
| Q |
10 |
catcatcagtacttttattcacctcagttattctcccttcaacttggaggttaacaggaggttatgtgtattcgaggataacaaggatgacaataggata |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51342111 |
catcatcggtacttttattcacctcagttattctcccttcaacttggaggttaacaggaggttatgtgtattcgaggataacaaggatgacaataggata |
51342012 |
T |
 |
| Q |
110 |
cttgttcctttatgcctctgctttggtcatgggtctgttttctactatgtctggtgttgttttggtctatgatttc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51342011 |
cttgttcctttatgcctctgctttggtcatgggtttgttttctactatgtctggtgttgttttggtctatgatttc |
51341936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University