View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16760_high_4 (Length: 219)
Name: NF16760_high_4
Description: NF16760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16760_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 16 - 68
Target Start/End: Original strand, 27838550 - 27838602
Alignment:
| Q |
16 |
gctagaacactcctcacctttggtgtagatcatggcattggtgcaggtttcca |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27838550 |
gctagaacactcctcacctttggtgtagatcatggcattggtgcaggtttcca |
27838602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 27832970 - 27833018
Alignment:
| Q |
16 |
gctagaacactcctcacctttggtgtagatcatggcattggtgcaggtt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27832970 |
gctagaacactcctcacctttggtgtagatcatcgcattggtgcaggtt |
27833018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 208
Target Start/End: Original strand, 27838707 - 27838736
Alignment:
| Q |
179 |
caggtggtggtgctggatatggagatgatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27838707 |
caggtggtggtgctggatatggagatgatg |
27838736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University