View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16760_low_4 (Length: 237)
Name: NF16760_low_4
Description: NF16760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16760_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 218
Target Start/End: Original strand, 38953797 - 38953994
Alignment:
| Q |
21 |
ccttattttgtacttcaattgttgtatttatcacatccatgttgtttgcagttcttccaaaacaactgtcagagaattatgatcacatctgaagattcca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38953797 |
ccttattttgtacttcaattgttgtatttatcacatccatgttgtttgcagttcttccaaaacaactgtcagagaattatgatcacatctgaagattcca |
38953896 |
T |
|
| Q |
121 |
aaatctgcatattggatcgaactgagattgttcagaaatacaaaggtacaacacttaatggttgcaccggtcctgatcaaaaaccttaatgttgcggt |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38953897 |
aaatctgcatattggatcaaactgagattgttcagaaatacaaaggtacaacacttaatggttgcaccggtcctgatcaaaaaccttaatgttgcggt |
38953994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University