View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16760_low_6 (Length: 219)
Name: NF16760_low_6
Description: NF16760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16760_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 52343789 - 52343990
Alignment:
| Q |
19 |
atgaaggcgtgcactat-actactaattaattacctgatagggtaaccatttcttcggctgtgaaacctttcttggcaaaagcagtgataaggccatcaa |
117 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52343789 |
atgaatgcgtgcactattactactaattaattacctgatagggtaaccatttcttcggctgtgaaacctttcttggcaaaagcagtgataaggccatcaa |
52343888 |
T |
|
| Q |
118 |
gattcaaaaagggagcaggtaacgtattagcttcacttaagtttgctgttgttgaatctcttctgcctaatagtacattccatctttgtccaccaagcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52343889 |
gattcaaaaagggagcaggtaacgtattagcttcacttaagtttgctgttgttgaatctcttctgcctaatagtacattccatctttgtccaccaagcta |
52343988 |
T |
|
| Q |
218 |
ta |
219 |
Q |
| |
|
|| |
|
|
| T |
52343989 |
ta |
52343990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 155 - 219
Target Start/End: Original strand, 9155341 - 9155405
Alignment:
| Q |
155 |
taagtttgctgttgttgaatctcttctgcctaatagtacattccatctttgtccaccaagctata |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
9155341 |
taagcttgctgttgttgaatctcttctgcctaatggtacattccagctttgtccgccaagctata |
9155405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 113
Target Start/End: Complemental strand, 26951617 - 26951552
Alignment:
| Q |
48 |
ttacctgatagggtaaccatttcttcggctgtgaaacctttcttggcaaaagcagtgataaggcca |
113 |
Q |
| |
|
|||||||||| | ||||||||||| || |||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
26951617 |
ttacctgataaagcaaccatttctttgggtgtgaaacctttattgttaaaagcattgataaggcca |
26951552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University