View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16761_high_1 (Length: 379)
Name: NF16761_high_1
Description: NF16761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16761_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 5 - 357
Target Start/End: Complemental strand, 30237840 - 30237490
Alignment:
| Q |
5 |
atattacattcgtttatatacatatccacatttgtttatatctactcacatcacatgtactctaattatttacagatgattgtggaagaaatgaatatct |
104 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30237840 |
atattatattcgtttatata--tatccacatttgtttatatctactcacatcacatgtactctaattatttacagatgattgtggaagaaatgaatatct |
30237743 |
T |
 |
| Q |
105 |
tgacaacagtgtttcttcgatatgacaatgagaaaatatattaccctaatgcagtcttgctcactaggccaataagcaatttttatagaagtccagaaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30237742 |
tgacaacagtgtttcttcgatatgacaatgagaaaatatattaccctaatgcagtcttgctcactaggccaataagcaatttttataggagtccagaaat |
30237643 |
T |
 |
| Q |
205 |
gagtgatgcaattgatttcaccattgatgttacaactcctatagaaactatcattgcactcaagaaatcaatacaaatgtaagttttctttatttattgt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30237642 |
gagtgatgcaattgatttcaccattgatgttacaactcctatagagactatcattgcactcaagaaatcaatacaaatgtaagttttctttatttattgt |
30237543 |
T |
 |
| Q |
305 |
tcttcttatgagtgaactttttagaaacaatccgattcaaaattaagagatgc |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30237542 |
tcttcttatgagtgaactttttagaaacaatccgattcaaaattaagagatgc |
30237490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University