View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16761_high_4 (Length: 268)
Name: NF16761_high_4
Description: NF16761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16761_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 4597996 - 4597884
Alignment:
| Q |
16 |
tcagtgtcaatgaaccagattggaacagtttgtataatgctagatgcaatttagcctctaagaaatctgttaaatagagccatttattttgacatggagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| || ||||||||||||||||||||| || ||||||| |
|
|
| T |
4597996 |
tcagtgtcaatgaaccagattggaacagtttgtataatgctatatacaatttagcctctcagaattcagttaaatagagccatttatttggatatggagt |
4597897 |
T |
|
| Q |
116 |
taagtttacattt |
128 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
4597896 |
taagcttacattt |
4597884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 185 - 259
Target Start/End: Original strand, 16367192 - 16367266
Alignment:
| Q |
185 |
caaacgtggtgtataaagaaattttcagaaatgtgtaatgtatgaattatgaattcatatcagttccattcattt |
259 |
Q |
| |
|
|||| ||||| ||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
16367192 |
caaatgtggtatataaagaaattttccaaaatttgtaatgtatgaattatgaaatcatatcagttccattgattt |
16367266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University