View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16761_low_6 (Length: 254)
Name: NF16761_low_6
Description: NF16761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16761_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 21597964 - 21597731
Alignment:
| Q |
18 |
tctggtatcttcgtcgttacaggtcaagaagctcgtctcgatgctggtccttccattatcctctcttacgccgcgtcaggtttctctgctcttctttcag |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21597964 |
tctggtatcttcgtcgttaccggtcaagaagctcgtttcgatgctggtccttccattatcctctcttacgccgcgtcaggtttctctgctcttctttcag |
21597865 |
T |
 |
| Q |
118 |
ctttaatctacgctgaattcgccgttgaagttcctgttgctggtggctcattttcattcctaagaattgaacttggtgattttctcgctttcattgccgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21597864 |
ctttaatctacgctgaattcgccgttgaagttcctgttgctggtggctcgttttcattccttagaattgaacttggtgattttctcgctttcattgccgc |
21597765 |
T |
 |
| Q |
218 |
tgggaatattctccttgaagctctcgtctgtgct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
21597764 |
tgggaatattctccttgaagctctcgtcggtgct |
21597731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 59 - 239
Target Start/End: Complemental strand, 11987687 - 11987507
Alignment:
| Q |
59 |
tgctggtccttccattatcctctcttacgccgcgtcaggtttctctgctcttctttcagctttaatctacgctgaattcgccgttgaagttcctgttgct |
158 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
11987687 |
tgctggtccttccattatcctctcctacgccgcttcaggattctcagctcttctttcagctttcatctatgctgaattcgcagttgaagttcccgttgcc |
11987588 |
T |
 |
| Q |
159 |
ggtggctcattttcattcctaagaattgaacttggtgattttctcgctttcattgccgctgggaatattctccttgaagct |
239 |
Q |
| |
|
||||| || |||| |||||||||||| ||||| ||||| || |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
11987587 |
ggtggttcgttttgattcctaagaatcgaactcggtgacttcctcgctttcattgctgccgggaatattctccttgaagct |
11987507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University