View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16762_low_9 (Length: 213)
Name: NF16762_low_9
Description: NF16762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16762_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 52132876 - 52133053
Alignment:
| Q |
16 |
tagcatagggaaaaaacagaaaatgatttctcaatcgaacttgacgtctttcaagaacatcatctttttaatttgttttgtaggtttcttttggttgctg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52132876 |
tagcatagggaaaaaacagaaaatgatttcacatccgaacttgacgtctttaatgaacatcatctttttaatttgttttttaggtttcttttggttgctg |
52132975 |
T |
|
| Q |
116 |
cttggtgttgagtgtaaaagagaagaaattattaaagagcagttgaatctgaatcaggtttattaaatgactatcttc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52132976 |
cttggtgttgagtgtaaaagagaagaaattattgaagagcagttgaatctgaatcaggtttattaaatgactatcttc |
52133053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University