View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16763_high_26 (Length: 214)
Name: NF16763_high_26
Description: NF16763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16763_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 56 - 188
Target Start/End: Complemental strand, 23704619 - 23704488
Alignment:
| Q |
56 |
ctcaaatgccgaaatgatctcccatttcaaaaatactcacttttagtcgttcttaaagtatttttaaagttcaaaaatggtacggcttatatgtgaacta |
155 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
23704619 |
ctcaaatgcggaaatgatctcccattttaaaaatactcacttttaatcgttcttaaag-atttttaaacttaaaaaatggtagcgcttatatgtgaacta |
23704521 |
T |
|
| Q |
156 |
tcttttattttagaataatatgtttttcttgac |
188 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |
|
|
| T |
23704520 |
tcttttattttggaataatatatttttcttgac |
23704488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 56 - 132
Target Start/End: Original strand, 40821672 - 40821747
Alignment:
| Q |
56 |
ctcaaatgccgaaatgatctcccatttcaaaaatactcacttttagtcgttcttaaagtatttttaaagttcaaaaa |
132 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||| |
|
|
| T |
40821672 |
ctcaaatgcggaaatgatctcccatttcaaaaatactcacttttagtcgttcttaaag-atttttaaactttaaaaa |
40821747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 40821807 - 40821839
Alignment:
| Q |
156 |
tcttttattttagaataatatgtttttcttgac |
188 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
40821807 |
tcttttattttggaataatatgtttttcttgac |
40821839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University