View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16763_high_5 (Length: 457)
Name: NF16763_high_5
Description: NF16763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16763_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 1 - 442
Target Start/End: Complemental strand, 37967387 - 37966939
Alignment:
| Q |
1 |
cacggaagtttgaggcaataacatctgccaacataatctgcgtcgaactcaatctgggcagaagaaagacatttctgattccacacagtccatttcggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37967387 |
cacggaagtttgaggcaataacatctgccaacataatctgcgtcgaactcaatctgggcagaagaaagacatttctgattccacacagtccatttcggtt |
37967288 |
T |
|
| Q |
101 |
ctgccatatgcccgatatcatcatcaaaacacaagtaatataatcacttcttgatcatgggtacacacatccatcaatacagcaccaacctagtcaaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37967287 |
ctgccatatgcccgatatcatcatcaaaacacaagta--ataatcacttcatgatcatgggtacacacatccatcaatacagcaccaacctagtcaaaat |
37967190 |
T |
|
| Q |
201 |
gttgcagacggggctgcaaaatgtgtgacaaacccgcagtactccagtattcagt-ctggtatcacattggaaaaataagtgccaatcatg--------c |
291 |
Q |
| |
|
| | ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37967189 |
gcttcagacggggctgcaaaatgtgcgacaaacccgcagtactccagtattcagtactggtatcacattggaaaaataagtgccaatcatgccccccccc |
37967090 |
T |
|
| Q |
292 |
tccgccctgcaggaaacatttagtaacacggcggtttataaaatcttcaggaaacattccaatagaaatagaaatgtgatcttgttcttatgcggtcttt |
391 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37967089 |
ccccccctacaggaaacatttagtaacacggcggtttataaaatcttcaggaaacattccaatagaaatagaaatgtgatcttgttcttatgcggtcttt |
37966990 |
T |
|
| Q |
392 |
tttctgatagaatttgttatactcagaattttgaatgtctgttaccgtgat |
442 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37966989 |
tttctgatagaatttgttatactcagaattttgaatgtctgttaccgtgat |
37966939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University