View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16763_high_8 (Length: 397)
Name: NF16763_high_8
Description: NF16763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16763_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 11 - 322
Target Start/End: Complemental strand, 404396 - 404085
Alignment:
| Q |
11 |
cacagataagtgacaaagcttgagattaacaagggttgtacaacgcagaatgttggtaggaaagtgagctcgtctaggctcccaagtattgatagcatga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
404396 |
cacagataagtgacaaagcttgagattaacaagggttgtacaacgcagaatgttggtaggaaagtgagctcgtctaggctcccaagtattgatagcatga |
404297 |
T |
 |
| Q |
111 |
atagagagatacattatcagcatatatagttgatccatttgttgaggaatttgaaatgaatcgtattcaatgtcgaggaagaaactgttgatggaatgaa |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
404296 |
atagagagatacattaacagcatatatagttgaaccatttgttgaggaatttgaaatgaattgtattcaatgtcgaggaagaaactgttgatggaatgaa |
404197 |
T |
 |
| Q |
211 |
aaccaacgagttctcgctcaagaaacatggaggaaaaaatatggttgaaaagctgaagtctataacgggaacgaaaggccatagaggacgaatgttccat |
310 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
404196 |
aaccaacgagttctcgctcaagaaaaatggaggaaaaaatatggttgaaacgctgaagtctataacgggaacgaaaggccataggggacgaatgttccat |
404097 |
T |
 |
| Q |
311 |
ctcttggagaga |
322 |
Q |
| |
|
|||||||||||| |
|
|
| T |
404096 |
ctcttggagaga |
404085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 975456 - 975497
Alignment:
| Q |
168 |
gaatcgtattcaatgtcgaggaagaaactgttgatggaatga |
209 |
Q |
| |
|
||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
975456 |
gaatcgtattcaatgtcaaggatgaaagtgttgatggaatga |
975497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University