View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16763_low_21 (Length: 277)
Name: NF16763_low_21
Description: NF16763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16763_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 31010554 - 31010303
Alignment:
| Q |
18 |
ataaccagaccatggttttaaattacggtttcggtaaacattgcagttctgatgtcattgtagagacctcactatcctttatattgcagccgcaaacagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||| | |
|
|
| T |
31010554 |
ataaccagaccatggttttaaattacggtttcgataaacattgcagttgtgatgtcattgtagagacctcaatatcctttatattgcggccgcaaacaat |
31010455 |
T |
 |
| Q |
118 |
ttaaaaccatgatcaagagattttattgtttaatcaagcctgacggtaaaaaatatcaattaggcaagaccaagttcccaacactgcaataacaatccca |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31010454 |
ttaaaaccatgattaagagattttattgtttaatcaagcctgagggtaaaaaatatccattaggcaagaccaagttcccaacactgcaataacaatccca |
31010355 |
T |
 |
| Q |
218 |
aacaccataattgctccatcaaaaaccaaacatttccaacccaattcatctc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31010354 |
aacaccataattgctccatcaaaaaccaaacatttccaacccaattcatctc |
31010303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University