View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16763_low_25 (Length: 241)
Name: NF16763_low_25
Description: NF16763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16763_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 18189279 - 18189482
Alignment:
| Q |
17 |
catgaggatccgttgctgcgtgtgctgccagactcaatccgaagtctttcggagaaagaaactgcaagtggattggaatctgggagggttgaggagaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189279 |
catgaggatccgttgctgcgtgtgctaccagactcaatccgaagtctttcggagaaagaaactgcaagtggattggaatctgggagggttgaggagaaaa |
18189378 |
T |
 |
| Q |
117 |
agaagtataatgtttttgatgtattgaaatttctcgcagagacatctgataaaaaagaagatgatgttcttactttgctggaaactctaaagcgttctgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18189379 |
agaagtataatgtttttgatgtattgaaatttctcgcagagacatctgataaaaaagaagatgatggtcttactttgctggaaactctaaagcgttctgg |
18189478 |
T |
 |
| Q |
217 |
tgtt |
220 |
Q |
| |
|
|||| |
|
|
| T |
18189479 |
tgtt |
18189482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 127 - 217
Target Start/End: Original strand, 54631827 - 54631914
Alignment:
| Q |
127 |
tgtttttgatgtattgaaatttctcgcagagacatctgataaaaaagaagatgatgttcttactttgctggaaactctaaagcgttctggt |
217 |
Q |
| |
|
|||||||||||| ||||||||||| || |||| |||| |||| |||||||||| |||||||||| |||||||| |||||||| ||||| |
|
|
| T |
54631827 |
tgtttttgatgtgttgaaatttcttgcgaagacttctgttaaa---gaagatgatggtcttactttgttggaaactttaaagcgtgctggt |
54631914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University