View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16763_low_30 (Length: 214)

Name: NF16763_low_30
Description: NF16763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16763_low_30
NF16763_low_30
[»] chr4 (1 HSPs)
chr4 (56-188)||(23704488-23704619)
[»] chr3 (2 HSPs)
chr3 (56-132)||(40821672-40821747)
chr3 (156-188)||(40821807-40821839)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 56 - 188
Target Start/End: Complemental strand, 23704619 - 23704488
Alignment:
56 ctcaaatgccgaaatgatctcccatttcaaaaatactcacttttagtcgttcttaaagtatttttaaagttcaaaaatggtacggcttatatgtgaacta 155  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||| || ||||||||||  ||||||||||||||||    
23704619 ctcaaatgcggaaatgatctcccattttaaaaatactcacttttaatcgttcttaaag-atttttaaacttaaaaaatggtagcgcttatatgtgaacta 23704521  T
156 tcttttattttagaataatatgtttttcttgac 188  Q
    ||||||||||| ||||||||| |||||||||||    
23704520 tcttttattttggaataatatatttttcttgac 23704488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 56 - 132
Target Start/End: Original strand, 40821672 - 40821747
Alignment:
56 ctcaaatgccgaaatgatctcccatttcaaaaatactcacttttagtcgttcttaaagtatttttaaagttcaaaaa 132  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||    
40821672 ctcaaatgcggaaatgatctcccatttcaaaaatactcacttttagtcgttcttaaag-atttttaaactttaaaaa 40821747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 40821807 - 40821839
Alignment:
156 tcttttattttagaataatatgtttttcttgac 188  Q
    ||||||||||| |||||||||||||||||||||    
40821807 tcttttattttggaataatatgtttttcttgac 40821839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University