View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16765_high_23 (Length: 222)
Name: NF16765_high_23
Description: NF16765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16765_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 3 - 203
Target Start/End: Original strand, 15555738 - 15555943
Alignment:
| Q |
3 |
ctatcctttggataaaattgaattttcatttacttttggaagcaaggagaaggttagggcagggagagaagggaaatatacagtgtg----acaactaac |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |||| ||||||| ||| | |||||| |
|
|
| T |
15555738 |
ctatcctttggataaaattgaattctcatttacttttggaagcaaggagaaggttagggaggggagagagcggaactatacagagtgtgaaaaaactaat |
15555837 |
T |
|
| Q |
99 |
ctctttgttggatattactgcaaatgtcttacagattcatatgctcaaagaacccattaattgaaa-ttttacacttgatcaaatagaaagaatggttct |
197 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
15555838 |
ctctttgttggatattaccgcagatgtcttacagattcagatgctcaaagaacccattaattgaaatttttacacttgatcaaatacaaagaatggttct |
15555937 |
T |
|
| Q |
198 |
tttgac |
203 |
Q |
| |
|
|||||| |
|
|
| T |
15555938 |
tttgac |
15555943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University