View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16765_low_28 (Length: 213)
Name: NF16765_low_28
Description: NF16765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16765_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 9 - 198
Target Start/End: Original strand, 25179590 - 25179779
Alignment:
| Q |
9 |
gagtagcaaaggtggttttggtgggtctttgggaacgtggcttgatgtagcatgaagggattgaggttaggccactttcagctaaggcttggactcgaac |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25179590 |
gagtagcaaaagtggttttggtgggtctttgggaacgtggcttgatgtagcatgaagggattgaggttaggccactttcagctaaggcttggactcgaac |
25179689 |
T |
 |
| Q |
109 |
tataggctctggccatgcttgggcacaactcatcattttctcttttgggtgtgtttgtgtttcacttttgggttatagatagatgaaact |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25179690 |
tataggctctggccatgcttgggcacaactcatcattttttcttttgggtgtgtttgtgtttcacttttgggttatagatagatgaaact |
25179779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 104
Target Start/End: Complemental strand, 4776582 - 4776542
Alignment:
| Q |
64 |
agggattgaggttaggccactttcagctaaggcttggactc |
104 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
4776582 |
agggattgagcttatgccactttcagctaaggcttggactc |
4776542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University