View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16766_high_10 (Length: 374)
Name: NF16766_high_10
Description: NF16766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16766_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 13 - 355
Target Start/End: Complemental strand, 39951646 - 39951305
Alignment:
| Q |
13 |
aatataccaaagaagtaggacagttagtagcctagaaaaatagcttaattagttgaacttcatgcaactggttacaatctcatgaattatgataccttag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39951646 |
aatataccaaagaagtaggacagttagtagcctagaaaaatagcttaattagttgaacttcatgcaactggttacaatctcatgaattatgataccttag |
39951547 |
T |
|
| Q |
113 |
aattctccaaatcattcagtgaatagattattttaaagggggaaaagtctgataaaggacattgcttcagcctctggcaggtttggggcatcaaacaatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39951546 |
aattctccaaatcattcagtgaatagattattttaaggggggaaa-gtctgataaaggatattgcttcagcctctggcaggtttggggcatcaaacaatt |
39951448 |
T |
|
| Q |
213 |
tgtaaacgagctgttcacctttccccttcctgaacattagccttatggtggccgcatgagctagcacatgcccccctgctggtttcttcgatcagtatag |
312 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39951447 |
tgtaaacgcgctgttcacctttccccttcctgaacattagccttatggtggccgcatgagctagcacatgcccccctgctggtttcttcgatcagtaatg |
39951348 |
T |
|
| Q |
313 |
aagataccccctccaggatcagctatgaatgcaaccaaaactc |
355 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
39951347 |
aagataccacctccaggatcagctatgactgcaaccaaaactc |
39951305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 127 - 355
Target Start/End: Complemental strand, 46402907 - 46402679
Alignment:
| Q |
127 |
ttcagtgaatagattattttaaagggggaaaagtctgataaaggacattgcttcagcctctggcaggtttggggcatcaaacaatttgtaaacgagctgt |
226 |
Q |
| |
|
|||| |||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||| |||| | ||| |
|
|
| T |
46402907 |
ttcaatgaataaattattttaa-gggggaaaagtctgataaaggatattgcttcagcctctggcaggtttggggcgtcaaacactttgcaaacacgttgt |
46402809 |
T |
|
| Q |
227 |
tcacctttccccttcctgaacattagccttatggtggccgcatgagctagcacatgcccccctgctggtttc-ttcgatcagtatagaagataccccctc |
325 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||| ||| ||||| |||| |
|
|
| T |
46402808 |
tcacctttccccttcctgaacatcagccttatggtggctgcatgagctagcacatgcccccctgctggtttctttggatcagtaatgaacataccacctc |
46402709 |
T |
|
| Q |
326 |
caggatcagctatgaatgcaaccaaaactc |
355 |
Q |
| |
|
| ||||||||||||| |||||||||||||| |
|
|
| T |
46402708 |
ctggatcagctatgactgcaaccaaaactc |
46402679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University