View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16766_high_16 (Length: 252)
Name: NF16766_high_16
Description: NF16766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16766_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 54689168 - 54688944
Alignment:
| Q |
18 |
ctaacaatactgcagttgttgctttggcatcacagcagtactacacatgtgcaaatggttatgtttacaattaaaaacacgttttcggtgaagcatctgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54689168 |
ctaacaatactgcagttgttgctttggcatcacagcagtactacacatgtgcaaatggttatgtttacgattaaaaacacgttttcggtgaagcatctgt |
54689069 |
T |
|
| Q |
118 |
attgaaaatgttataatcatgcaaatgagacagattatgagttggggagattccttgggggagacaaggctctaacatttatgtaattatgtctgaatcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54689068 |
attgaaaatgttataatcatgcaaatgagacagattatgagttggggagattccttgggggagacaaggctctaacatttatgtaattatgtctgaatcc |
54688969 |
T |
|
| Q |
218 |
aaatctggattagttggcctctctg |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
54688968 |
aaatctggattagttggcctctctg |
54688944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 34 - 238
Target Start/End: Complemental strand, 54701101 - 54700895
Alignment:
| Q |
34 |
tgttgctttggcatcacagcagt--actacacatgtgcaaatggttatgtttacaattaaaaacacgtttt-cggtgaagcatctgtattgaaaatgtta |
130 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||||||||||||| |||| ||||||| ||| |||| ||||||||||| || ||||||||||||| |
|
|
| T |
54701101 |
tgttgctttagcatcacagcagagaactaaacatgtgcaaatggttatatttaagattaaaa-cacatttttcggtgaagcatttgcattgaaaatgtta |
54701003 |
T |
|
| Q |
131 |
taatcatgcaaatgagacagattatgagttggggagattccttgggggagacaaggctctaacatttatgtaattatgtctgaatccaaatctggattag |
230 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54701002 |
taatcatgcaaatgagacagagtatgagttggggagattccttgggggagacaaggctctaacatttatgtaattatgtctgaatccaaatctggattag |
54700903 |
T |
|
| Q |
231 |
ttggcctc |
238 |
Q |
| |
|
|||||||| |
|
|
| T |
54700902 |
ttggcctc |
54700895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 233
Target Start/End: Complemental strand, 54693633 - 54693554
Alignment:
| Q |
154 |
atgagttggggagattccttgggggagacaaggctctaacatttatgtaattatgtctgaatccaaatctggattagttg |
233 |
Q |
| |
|
||||||||| ||| |||| || |||||||| |||||||||||||| |||||||||| | ||||||||| |||||||| |
|
|
| T |
54693633 |
atgagttggagagtttccatgagggagacacttctctaacatttatgcaattatgtctaattccaaatcttaattagttg |
54693554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University