View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16766_high_21 (Length: 209)

Name: NF16766_high_21
Description: NF16766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16766_high_21
NF16766_high_21
[»] chr7 (1 HSPs)
chr7 (16-190)||(9424233-9424407)


Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 190
Target Start/End: Original strand, 9424233 - 9424407
Alignment:
16 atgaactacggctgcagctctagtattatgcgtccaaatttcggcagtaaccacgttacagcgaaggtctgcaagaaccgcacagatttcagatagtaaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9424233 atgaactacggctgcagctctagtattatgcgtccaaatttcggcagtaaccacgttacagcgaaggtctgcaagaaccgcacagatttcagatagtaaa 9424332  T
116 ccaggcctgtctgtgccagtgagttcaataacagtgtgctcttcggtacgtacaaccccaacagactctctcatt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||    
9424333 ccaggcctgtctgtgccagtgagttcaataacagtgtgctcttcggtaggtacaaccccaacagattctctcatt 9424407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University