View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16767_high_16 (Length: 237)
Name: NF16767_high_16
Description: NF16767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16767_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 95 - 209
Target Start/End: Original strand, 16641402 - 16641515
Alignment:
| Q |
95 |
aagtgtatgtttgtctcttgtggacgtggttgaacaccttggatactcatggatcattaaacaaccaccactttgttgaatttaatggctactcatgtga |
194 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| | |
|
|
| T |
16641402 |
aagtgtatttttgtctcttgtggacgtggctgaacaccttggatactcatggatcattaaacaaccaccac-ttgttggatttaatggctactcatgtaa |
16641500 |
T |
 |
| Q |
195 |
ctgacacttgtttct |
209 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16641501 |
ctgacacttgtttct |
16641515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 16641180 - 16641213
Alignment:
| Q |
1 |
gttccacttcagccttttcctatatcttatctaa |
34 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
16641180 |
gttccacttcaaccttttcctatatcttatctaa |
16641213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University