View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16767_low_12 (Length: 334)
Name: NF16767_low_12
Description: NF16767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16767_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 8437873 - 8438196
Alignment:
| Q |
1 |
caaaaataacagtatcattcatttgtctcgacaacttaatcactgtcggataaaccttaacacatggcccacaatgtttaagaccaacatcaagaacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437873 |
caaaaataacagtatcattcatttgtctcgacaacttaatcactgtcggataaaccttaacacatggcccacaatgtttaagaccaacatcaagaacaat |
8437972 |
T |
 |
| Q |
101 |
aagcttatgatcaatcttatgatcctcaataagtttctcaacatcttctctgttgtgaagttgcactacacctgaatggttatcaccgtagtataacaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8437973 |
aagcttatgatcaatcttatgatcctcaataagtttctcaacatcttctctgttgtgaagttgcactacacctgaatggttatcaccgtagtataaaaca |
8438072 |
T |
 |
| Q |
201 |
tcaccaacaagcatatctggaccaatagcttcttcttcatgaattttttctttgctcttgtagaaagtgaagtgtggtactttatcaaccttttctcttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438073 |
tcaccaacaagcatatctggaccaatagcttcttcttcatgaattttttctttgctcttgtagaaagtgaagtgtggtactttatcaaccttttctcttt |
8438172 |
T |
 |
| Q |
301 |
tacagagttcttttgttttctctg |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8438173 |
tacagagttcttttgttttctctg |
8438196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University