View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16767_low_19 (Length: 252)
Name: NF16767_low_19
Description: NF16767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16767_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 8437894 - 8437680
Alignment:
| Q |
17 |
atgaatgatactgttatttttgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437894 |
atgaatgatactgttatttttgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttt |
8437795 |
T |
 |
| Q |
117 |
tgttcattagagatggtaagattgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttactta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437794 |
tgttcattagagatggtaagattgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttactta |
8437695 |
T |
 |
| Q |
217 |
tt-aaatcaaatcaa |
230 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
8437694 |
ttaaaatcaaatcaa |
8437680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University