View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16767_low_21 (Length: 237)

Name: NF16767_low_21
Description: NF16767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16767_low_21
NF16767_low_21
[»] chr2 (2 HSPs)
chr2 (95-209)||(16641402-16641515)
chr2 (1-34)||(16641180-16641213)


Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 95 - 209
Target Start/End: Original strand, 16641402 - 16641515
Alignment:
95 aagtgtatgtttgtctcttgtggacgtggttgaacaccttggatactcatggatcattaaacaaccaccactttgttgaatttaatggctactcatgtga 194  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |    
16641402 aagtgtatttttgtctcttgtggacgtggctgaacaccttggatactcatggatcattaaacaaccaccac-ttgttggatttaatggctactcatgtaa 16641500  T
195 ctgacacttgtttct 209  Q
    |||||||||||||||    
16641501 ctgacacttgtttct 16641515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 16641180 - 16641213
Alignment:
1 gttccacttcagccttttcctatatcttatctaa 34  Q
    ||||||||||| ||||||||||||||||||||||    
16641180 gttccacttcaaccttttcctatatcttatctaa 16641213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University