View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16768_high_28 (Length: 362)
Name: NF16768_high_28
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16768_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 81 - 182
Target Start/End: Original strand, 42859345 - 42859446
Alignment:
| Q |
81 |
taatcgaaatttacattaacctctcttcaagatactagcgggcttgaacccaaaactttcaaatttaacatccatctttttaccactaaattaaacctag |
180 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42859345 |
taatcgaaatttacattaacctctcttgaagatactagcgggtttgaacccaagactttcaaatttaacatccatctttttaccactaaattaaacctag |
42859444 |
T |
|
| Q |
181 |
ag |
182 |
Q |
| |
|
|| |
|
|
| T |
42859445 |
ag |
42859446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 272 - 355
Target Start/End: Original strand, 42859540 - 42859618
Alignment:
| Q |
272 |
tttcattttggtcacttagcttaaaaatatcagatgttttgatcttttaaactataaaatttagatatttcggtcattcatatc |
355 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
42859540 |
tttcattttggtcacttaacttaaaaatattagatgttttgatcttttaa-----aaaatgtagacatttcggtcattcatatc |
42859618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University